View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_high_5 (Length: 542)
Name: NF0545_high_5
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0545_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 5e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 13 - 120
Target Start/End: Original strand, 41133265 - 41133372
Alignment:
| Q |
13 |
aatatgatagatgaatggggaaattatgctatgatttaagacgagcatgtgagtgaaagtgtgattgagaacttgagaaagtatgattttgcgtaattgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
41133265 |
aatatgatagatgaatggggaaattatgatatgatttaacacgagcatgtgagtgaaagggtgattgggaacttgagaaagtgtgattttgcgtaattgt |
41133364 |
T |
 |
| Q |
113 |
gaacttgt |
120 |
Q |
| |
|
|||||||| |
|
|
| T |
41133365 |
gaacttgt |
41133372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 128 - 168
Target Start/End: Complemental strand, 41132789 - 41132749
Alignment:
| Q |
128 |
tgaaatatacgactcatgcaaatgatgacactcattaagga |
168 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
41132789 |
tgaaatatactactcatgcaattgatgacactcattaagga |
41132749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 63; Significance: 4e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 475 - 541
Target Start/End: Complemental strand, 50157259 - 50157193
Alignment:
| Q |
475 |
gaccaaaacaattaagttccaacatccatgcactccgctctattatgttttgccaaccgagacagtg |
541 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50157259 |
gaccaaaacaattaagttccaacatccatgcactccgctctattatgttttgccaactgagacagtg |
50157193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University