View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_low_2 (Length: 634)
Name: NF0545_low_2
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0545_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 4e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 4e-49
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 1331359 - 1331175
Alignment:
| Q |
1 |
cgtcatcatcaacaaaattttcaacatgagtaataacaagtgttgcacccgcgcttcaaaagccttggaggatgctatgccgtatgtattctccttgtca |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1331359 |
cgtcattatcaacaaaattttcaacatgagtaataacaagtg--------gcacttcaaaagccttggaggatgctatgccgtatgcattctccttgtca |
1331268 |
T |
 |
| Q |
101 |
acatatttatgaattgttttctttgaaacatatgc-gggnnnnnnnnaccacgatctacattttccacaaccttccgagggattaaccaacga |
192 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||| |||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
1331267 |
acatatttatgaattgttttcttcgaaacatatgcaggtttttttttaccatgatctacattttccacaatcttccgagggatcaaccaacga |
1331175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 417 - 477
Target Start/End: Complemental strand, 9455062 - 9455002
Alignment:
| Q |
417 |
cctcctcatggtggtcctcatgagatctaactttgtcgttatcttcctcctttgtattatc |
477 |
Q |
| |
|
||||||||||||||||||| |||||| ||| || |||||||||||||||| ||| ||||| |
|
|
| T |
9455062 |
cctcctcatggtggtcctcgtgagattaaacattatcgttatcttcctcctctgtcttatc |
9455002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University