View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_low_24 (Length: 367)
Name: NF0545_low_24
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0545_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 30 - 356
Target Start/End: Original strand, 11635846 - 11636171
Alignment:
Q |
30 |
tagatttgcagagaatatagttgccgtaggacctatatttatatttaaaatgttaggtagagaaacttaaacgtgtattgtttgtcttgctggtttgcag |
129 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11635846 |
tagatttgcacagaatatagttgccgtaggacctat--ttatatttaaaatgttaggtacagaaacttaaacgtgtattgtttgtcttgctggtttgcag |
11635943 |
T |
 |
Q |
130 |
gtgcatcgtgcaaactgcagtggatctaaatactttgtctgatggtttctactcatccacacaaaataaataaattgtcattttagt-tttgaacgtgta |
228 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
T |
11635944 |
gtgcatcgtgcaaattgcagtggatctaaatactttgtctgatggtttctactcatccacacaaaataaataaattgtcattttagtctttgaacatgta |
11636043 |
T |
 |
Q |
229 |
aaatgtttgatgtgtcaagagttaaggttcaaaaacatataaataattgaattcttaaacccgtaactttaaggtttttggttaagatatgatgctctac |
328 |
Q |
|
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
11636044 |
aaatgttttatgtgtcaagagttaaggttcaacaacatataaataattgaatttctaaacccgtaactttaaggtttttggttaagatatgatgctcaat |
11636143 |
T |
 |
Q |
329 |
tcatttatgtagttgttcttagtttcat |
356 |
Q |
|
|
|||||||||| |||||||| |||||||| |
|
|
T |
11636144 |
tcatttatgtggttgttctcagtttcat |
11636171 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University