View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_low_29 (Length: 340)
Name: NF0545_low_29
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0545_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 43 - 311
Target Start/End: Complemental strand, 33117134 - 33116866
Alignment:
Q |
43 |
aaactaacataaactaactcaaccattctgagaggcgattctcttattccaaaacttgaattgcagagtcctttgttcaagcatcttctccacttcctca |
142 |
Q |
|
|
|||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
33117134 |
aaactaactcaaactgactcaacccttctgagaggcgattctcttattccaaaacttgaattgcagagtcctttgttgaagcatcttctccacttcctca |
33117035 |
T |
 |
Q |
143 |
attggaacacctttggtttctggtacgaaaacgaggacaaagaaaattgctatgacagcaacaattccaaacaacatgaatgtccatgcaactccaatag |
242 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33117034 |
attggaacacctttggtttctggtacgaaaacgaggacaaaggaacttgctatgacagcaacaattccaaacaacatgaatgtccatgcaactccaatag |
33116935 |
T |
 |
Q |
243 |
cttgtgtgagagataaaaaggattgagaaacaataaggtttgagatccaaacacttgttgaagccattc |
311 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33116934 |
cttgtgtgagagataaaaaggattgagaaacaataaggtttgagatccaaacacttgttgaagccattc |
33116866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 652 times since January 2019
Visitors: 3655