View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_low_31 (Length: 339)
Name: NF0545_low_31
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0545_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 89 - 273
Target Start/End: Original strand, 4243604 - 4243788
Alignment:
Q |
89 |
ccgttatcagtctttgtgttcccggtgaaatatcgaatcaacagaacaacaaggactaaaaatgcgacagccaaaccaacctttccgattgaggatgtaa |
188 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4243604 |
ccgttatcagtctttgtgttcccggtgaaatatcgaatcaacagaacaacaaggactaaaaatgcgacagccaaaccaacctttccgattgaggatgtaa |
4243703 |
T |
 |
Q |
189 |
gtttattcaaccttgtttgcaaaggggtttcttcgttgatgtcattgcttatggaactcatcatttgtccccatgttgtgttcat |
273 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4243704 |
gtttattcaaccttgtttgcaaaggggtttcttcgttgatgtcattgcttatggaactcatcatttgtccccatgttgtgttcat |
4243788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 116; Significance: 6e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 94 - 273
Target Start/End: Original strand, 6186665 - 6186844
Alignment:
Q |
94 |
atcagtctttgtgttcccggtgaaatatcgaatcaacagaacaacaaggactaaaaatgcgacagccaaaccaacctttccgattgaggatgtaagttta |
193 |
Q |
|
|
|||||||||||| ||||||||||||||||||| ||| |||||||| ||||||||||| |||||| |||||||||| |||||||| || ||||| || ||| |
|
|
T |
6186665 |
atcagtctttgtattcccggtgaaatatcgaaccaagagaacaaccaggactaaaaacgcgacaaccaaaccaacttttccgatcgatgatgttagctta |
6186764 |
T |
 |
Q |
194 |
ttcaaccttgtttgcaaaggggtttcttcgttgatgtcattgcttatggaactcatcatttgtccccatgttgtgttcat |
273 |
Q |
|
|
|||||||||||||||||||| ||||| || | ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
6186765 |
ttcaaccttgtttgcaaaggtgtttcctcatcgatgtcattgcttatcgaactcatcatttgtccccatgttgtgttcat |
6186844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 885 times since January 2019
Visitors: 3657