View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_low_35 (Length: 325)
Name: NF0545_low_35
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0545_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 1e-72; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 143 - 305
Target Start/End: Complemental strand, 30360908 - 30360746
Alignment:
Q |
143 |
tccttttataatgtttgattatcgtgaacagtgctggatggtgtggtgatgtgttactgctacgtgtttgcagcttaagtattgttggtgcaagtgtcgt |
242 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
T |
30360908 |
tccttttataatgtttggttatcgtgaacagtgctggattgtgtggtgatgtgttactgctacgtgtttgcagcttaagtattattggtgcaagtgtctt |
30360809 |
T |
 |
Q |
243 |
acttgctttggcggtttgacatgtgtcttgtctctttttattccttgctttatttgatgatgt |
305 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
30360808 |
acttgctttggcagtttgacatgtgtcttgtctctttttattccttgctttattttatgatgt |
30360746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 164 - 240
Target Start/End: Complemental strand, 30356297 - 30356219
Alignment:
Q |
164 |
tcgtgaacagtgctggatggtgt-ggtgatgtgttactgctacgtgtttgcagc-ttaagtattgttggtgcaagtgtc |
240 |
Q |
|
|
|||||||||||||||||||| | ||||||||||||||||||||||| || ||| ||||||||| |||||||| ||||| |
|
|
T |
30356297 |
tcgtgaacagtgctggatgggttcggtgatgtgttactgctacgtgtctgtagctttaagtattattggtgcaggtgtc |
30356219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 38 - 77
Target Start/End: Complemental strand, 30361015 - 30360975
Alignment:
Q |
38 |
ctttaatttcaagcaaaataaa-ttagctggagcttgtaat |
77 |
Q |
|
|
|||||||||||||||||||||| |||||| ||||||||||| |
|
|
T |
30361015 |
ctttaatttcaagcaaaataaatttagctagagcttgtaat |
30360975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University