View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_low_39 (Length: 285)
Name: NF0545_low_39
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0545_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 40 - 264
Target Start/End: Complemental strand, 43206092 - 43205869
Alignment:
| Q |
40 |
caactaagggggttaaaagagaaaattttccataacatgaggccgtatgtaaagnnnnnnngttgaatgaaatatgtaattagtaaatcattatttttgt |
139 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43206092 |
caactaagggggttaaaagagcaaattttccataacatgaggcagtatgtaaagaaaaaa-gttgaatgaaatatgtaattagtaaatcattatttttgt |
43205994 |
T |
|
| Q |
140 |
cttaaaaattgtaataatnnnnnnncttttgactgacactgttgtttaaaggcgattaatctcgatccgaaaacctctttaatgcataatgtgagttctc |
239 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43205993 |
cttaaaaattgtaataataaaaaaacttttgactgacatcgttgtttaaaggcgattaatctccatcgaaaaacctctttaatgcataatgtgagttctc |
43205894 |
T |
|
| Q |
240 |
tgctcacaattgaataattttcatc |
264 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43205893 |
cgctcacaattgaataattttcatc |
43205869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 306 times since January 2019
Visitors: 3649