View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_low_49 (Length: 251)
Name: NF0545_low_49
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0545_low_49 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 81 - 251
Target Start/End: Original strand, 28491924 - 28492092
Alignment:
| Q |
81 |
ttcttttattagtaaaaaaggtatgatttatatttgatttaaaatattgacatctgaattatctcaattgctaaacttagaagttagaattttgaaattt |
180 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
28491924 |
ttcttttattagtaaaaaaggaataatttatatttgatttaaaatattgacatctgaattatc--aattgctaaacttagaagttagaaatttgaaattt |
28492021 |
T |
|
| Q |
181 |
tgggttttgttaaagttgggttctatgatggatcgatttgataaatgccgttagtggaaaactgcacgtca |
251 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| || |||||| |
|
|
| T |
28492022 |
tgggttttgttaaagttgggttttatgatggatcgatttgataaatgccaatagtggaaaagtgtacgtca |
28492092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 30 - 80
Target Start/End: Original strand, 28490706 - 28490756
Alignment:
| Q |
30 |
agtttaatactgatttgagtatatttgttgttgagttacacaagtcaatct |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28490706 |
agtttaatactgatttgagtatatttgttgttgagttacacaagtcaatct |
28490756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1763 times since January 2019
Visitors: 3673