View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_low_53 (Length: 251)
Name: NF0545_low_53
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0545_low_53 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 30 - 251
Target Start/End: Original strand, 56231903 - 56232124
Alignment:
Q |
30 |
ctcatttcctgcctgcaacacagattacttatgcagatggcgttgctctctttgcctacatcaattcaaccaagtaacttttgttgctctctccttttct |
129 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56231903 |
ctcatttcctacctgcaacacagattacttatgcagatggcgttgctctctttgcctacatcaattcaaccaagtaacttttgttgctctctccttttct |
56232002 |
T |
 |
Q |
130 |
catcccttcatttgtatagttggtcttcatagataattcaattatttcaacattgttctcttaacaccttacctttaatcaatgtcgttattatcacata |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56232003 |
catcccttcatttgtatagttggtcttcatagataattcaattatttcaacattgttctcttaacaccttacctttaatcaatgtcgttattatcacata |
56232102 |
T |
 |
Q |
230 |
acaggaatccactaggatatat |
251 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
56232103 |
acaggaatccactaggatatat |
56232124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 30 - 251
Target Start/End: Original strand, 39189697 - 39189914
Alignment:
Q |
30 |
ctcatttcctgcctgcaacacagattacttatgcagatggcgttgctctctttgcctacatcaattcaaccaagtaacttttgttgctctctccttttct |
129 |
Q |
|
|
|||||||||| ||| || |||| |||| ||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
T |
39189697 |
ctcatttcctacctacagcacatattatttatgaagatggtgttgctgtctttgcctacatcaattcaaccaagtaacttttgttgctc-ctccttttgt |
39189795 |
T |
 |
Q |
130 |
catcccttcatttgtatagt--tggtcttcatagataattcaattatttcaacattgttctcttaacaccttacctttaatcaatgtcgttattatcaca |
227 |
Q |
|
|
|||||||||||||| | | ||||||||||||||||||||| |||||||||||||||||||| ||| ||||| |||||||||||||||| | |
|
|
T |
39189796 |
catcccttcatttgctccctccttttcttcatagataattcaattaattcaacattgttctcttaac-----accgttaattaatgtcgttattatcata |
39189890 |
T |
 |
Q |
228 |
taacaggaatccactaggatatat |
251 |
Q |
|
|
||| |||||||||||||||||||| |
|
|
T |
39189891 |
taataggaatccactaggatatat |
39189914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University