View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0545_low_55 (Length: 247)

Name: NF0545_low_55
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0545_low_55
NF0545_low_55
[»] chr4 (1 HSPs)
chr4 (6-247)||(49764842-49765085)


Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 6 - 247
Target Start/End: Original strand, 49764842 - 49765085
Alignment:
6 ccaacaatatgggatccaaacacttttattttgatgaattttcttaggctgatgatgatattccaggacccttctc--tccagctatgcacatggaacgg 103  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||  ||||||||||||||||||||||    
49764842 ccaacaataagggatccaaacacttttattttgatgaattttcttaggctgatgatgatatcccaggacccttctctctccagctatgcacatggaacgg 49764941  T
104 aggagactagagagattgcggtaacaattgcaagtactgctgattaggtgcaaacgagagccattgaataaatgccacactctatattgctgctagtaca 203  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49764942 aggagactagagagattccggtaacaattgcaagtactgctgattaggtgcaaacgagagccattgaataaatgccacactctatattgctgctagtaca 49765041  T
204 tgatctactcattgaatgccaatcgaggggaccactaccaccat 247  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
49765042 tgatctactcattgaatgccaatcgaggggaccactaccaccat 49765085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1777 times since January 2019
Visitors: 3673