View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_low_6 (Length: 533)
Name: NF0545_low_6
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0545_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 102 - 419
Target Start/End: Complemental strand, 7108944 - 7108631
Alignment:
Q |
102 |
aatcttgcccttaaaatagacatttataaagcttttgacactgtggaatgaaaatttcttttgaagattttgaaagcttttggttttaatgaaaacattt |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7108944 |
aatcttgcccttaaaatagacatttataaagcttttgacactgtggaatgaaaatttcttttgaagattttgaaagcttttggttttaatgaaaacattt |
7108845 |
T |
 |
Q |
202 |
gtaattggatagaggtcattttaaactcatattctctgataatttctctcaatgataagcttcatgattattttcattgtaagagaggggtgaggcagga |
301 |
Q |
|
|
| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7108844 |
ggaattggatagaggtcattttaaactcatattgtctgataatttctctcaatgataagcttcatgattattttcattgtaagagaggggtgaggcagga |
7108745 |
T |
 |
Q |
302 |
atactgtatctatctctcctctccttttatgttttgccaaagaggtgatgagcagaagtatttctagattggtggatgaaggtaagctagaccttatcaa |
401 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7108744 |
atactgt----atctctcctctccttttatgttttgccaaagaggtgatgagcagaggtatttctagattggtggatgaaggtaagctagaccttatcaa |
7108649 |
T |
 |
Q |
402 |
ggggtccagaaaaccata |
419 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
7108648 |
ggggtccagaaaaccata |
7108631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University