View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0545_low_60 (Length: 214)
Name: NF0545_low_60
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0545_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 23 - 153
Target Start/End: Complemental strand, 54080378 - 54080248
Alignment:
| Q |
23 |
gttcattcttatacatggttcaagaatgctattatatttacccttctgagagtgacttactcagtgggggatcattgatcatttctgaactcttcttttg |
122 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54080378 |
gttcattcttatacaaggttcaagaatgctattatatttacccttctgagagtgacttactcagtaggggatcattgatcatttctgaactcttcttttg |
54080279 |
T |
 |
| Q |
123 |
gattcatttgttaatgatcatattcttggag |
153 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
54080278 |
gattcatttgttaatgatcatatttttggag |
54080248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University