View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0545_low_60 (Length: 214)

Name: NF0545_low_60
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0545_low_60
NF0545_low_60
[»] chr4 (1 HSPs)
chr4 (23-153)||(54080248-54080378)


Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 23 - 153
Target Start/End: Complemental strand, 54080378 - 54080248
Alignment:
23 gttcattcttatacatggttcaagaatgctattatatttacccttctgagagtgacttactcagtgggggatcattgatcatttctgaactcttcttttg 122  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
54080378 gttcattcttatacaaggttcaagaatgctattatatttacccttctgagagtgacttactcagtaggggatcattgatcatttctgaactcttcttttg 54080279  T
123 gattcatttgttaatgatcatattcttggag 153  Q
    |||||||||||||||||||||||| ||||||    
54080278 gattcatttgttaatgatcatatttttggag 54080248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University