View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0545_low_63 (Length: 208)

Name: NF0545_low_63
Description: NF0545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0545_low_63
NF0545_low_63
[»] chr7 (1 HSPs)
chr7 (1-143)||(9949373-9949515)


Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 9949515 - 9949373
Alignment:
1 ttgtatctcttttaatggtatatgtgatttatgaaaatatttaatataaattagaatatgatataccaggttttataaaccagaattcaatataaatcca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9949515 ttgtatctcttttaatggtatatgtgatttatgaaaatatttaatataaattagaatatgatataccaggttttataaaccagaattcaatataaatcca 9949416  T
101 aaggtttattgaaccagtattgaaattaaaccagttaccatct 143  Q
    |||||||||||||||||||||||||||||||||||||||||||    
9949415 aaggtttattgaaccagtattgaaattaaaccagttaccatct 9949373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University