View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0546_high_3 (Length: 265)
Name: NF0546_high_3
Description: NF0546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0546_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 15385666 - 15385790
Alignment:
| Q |
1 |
ggcagtatgtgggatttggaacagaaacttgaccagccaatggatgcagaagcaggaaggctcagaaatatgtacagagaaaaagtatgatgcaatgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15385666 |
ggcagtatgtgggatttggaacagaaacttgaccagccaatggatgcagaagcaggaaggctcagaaatatgtacagagaaaaagtatgatgcaatgaat |
15385765 |
T |
|
| Q |
101 |
tctattttgtttacataggaaactg |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
15385766 |
tctattttgtttacataggaaactg |
15385790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 4 - 125
Target Start/End: Original strand, 15394104 - 15394225
Alignment:
| Q |
4 |
agtatgtgggatttggaacagaaacttgaccagccaatggatgcagaagcaggaaggctcagaaatatgtacagagaaaaagtatgatgcaatgaattct |
103 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15394104 |
agtatgtgggatttgcaacagaaatttgaccagccaatggatgcagaagcaggaaggctcaaaaatatgtacagagaaaaagtatgatgcaatgaattct |
15394203 |
T |
|
| Q |
104 |
attttgtttacataggaaactg |
125 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
15394204 |
attttgtttacataggatactg |
15394225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 4 - 91
Target Start/End: Complemental strand, 38669765 - 38669678
Alignment:
| Q |
4 |
agtatgtgggatttggaacagaaacttgaccagccaatggatgcagaagcaggaaggctcagaaatatgtacagagaaaaagtatgat |
91 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| ||||| | ||| |||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
38669765 |
agtatgtgggatttggatcagaagcttgaccagcctatggaggaagaggcaggaagactcaggaatatgtacagagaaaaagtatgat |
38669678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1063 times since January 2019
Visitors: 3662