View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0546_low_3 (Length: 399)
Name: NF0546_low_3
Description: NF0546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0546_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 103 - 183
Target Start/End: Original strand, 2656666 - 2656746
Alignment:
| Q |
103 |
tgaataaaaatcacacaaacaatgtcactcttatgttaatccaaacccactcaacctgcataattttgcaggtcactctaa |
183 |
Q |
| |
|
||||||||||||||| | |||| |||||| | ||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2656666 |
tgaataaaaatcacagatacaaggtcactttcatgttaagctaaacccactcaacctgcataattttgcaggtcactctaa |
2656746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 28 - 71
Target Start/End: Original strand, 9593228 - 9593271
Alignment:
| Q |
28 |
tgtgaacttatttcttgactcattgtctaatctaaaagtcttct |
71 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9593228 |
tgtgaatttatttcttgactcattgtctattctaaaagtcttct |
9593271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 476 times since January 2019
Visitors: 3651