View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_101 (Length: 251)
Name: NF0547_high_101
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_high_101 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 152 - 244
Target Start/End: Original strand, 47060742 - 47060834
Alignment:
| Q |
152 |
ggttggcatattatctcaatcaagaaatttgagcagagaaaatgagtttcnnnnnnngtttctgccaattttcttcgcacctaagaataatct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
47060742 |
ggttggcatattatctcaatcaagaaatttgagcagagaaaatgagtttctttttttgtttctgccaattttcttcacacgtaagaataatct |
47060834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 16 - 55
Target Start/End: Original strand, 47060605 - 47060644
Alignment:
| Q |
16 |
gccaagaagtctcgccactttctattagtagatacaaata |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47060605 |
gccaagaagtctcgccactttctattagtagatacaaata |
47060644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University