View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_109 (Length: 251)
Name: NF0547_high_109
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_high_109 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 44999842 - 45000063
Alignment:
Q |
1 |
aatgtcttcagctgcagatgaaatgtcaccacattttgctacaatccttacactctctatcaactcttttgttctagcctcttgtgccaaaatttccatc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44999842 |
aatgtcttcagctgcagatgaaatgtcaccacattttgctacaatccttacactctctatcaactcttttgttctagcctcttgtgccaaaatttccatc |
44999941 |
T |
 |
Q |
101 |
aactgttctggactaatcaccaacttcactttccaaaacctgctgctactagacaaagattctatagaagacttcttgagaaacctcattccttggtggt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44999942 |
aactgttctggactaatcaccaacttcactttccaaaacctgctgctactagacaaagattctatagaagacttcttgagaaacctcattccttggtggt |
45000041 |
T |
 |
Q |
201 |
gttggtaatctaaggacattct |
222 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
45000042 |
gttggtaatctaaggacattct |
45000063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 27 - 137
Target Start/End: Complemental strand, 18245762 - 18245652
Alignment:
Q |
27 |
caccacattttgctacaatccttacactctctatcaactcttttgttctagcctcttgtgccaaaatttccatcaactgttctggactaatcaccaactt |
126 |
Q |
|
|
|||||||||| ||||||||||| ||||||||||||||||| || ||| | ||||||||| |||||| |||| ||||| ||| ||| | || ||| || |
|
|
T |
18245762 |
caccacatttggctacaatcctcacactctctatcaactccttggttgaaacctcttgtgacaaaatctccaacaacttttcaggagttatacacaattt |
18245663 |
T |
 |
Q |
127 |
cactttccaaa |
137 |
Q |
|
|
||||||||||| |
|
|
T |
18245662 |
cactttccaaa |
18245652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1846 times since January 2019
Visitors: 3673