View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_110 (Length: 251)
Name: NF0547_high_110
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_high_110 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 47806287 - 47806530
Alignment:
Q |
1 |
tcttcactttattggtatttacatgtttaaaatcaattgattttgaaacatgtacttt-cagtaattttatcttaaaatcatgctcatgcagatatgcaa |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47806287 |
tcttcactttattggtatttacatgtttaaaatcaattgattttgaaacatgtacttttcagtaattttatcttaaaatcatgctcatgcagatatgcaa |
47806386 |
T |
 |
Q |
100 |
ttttatccaaacaaaaaatatcattttgaataatcacttgtcctgtattgtcttttgttaaccaataaactttgtatgttctttaaggaatttgaggaaa |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47806387 |
ttttatccaaacaaaaaatatcattttgaataatcatttgtcctttattgtcttttgttaaccaataaactttgtatgttctttaaggaatttgaggaaa |
47806486 |
T |
 |
Q |
200 |
atgttgaggtgagaaaaggactaactgaagatgatgtctctgct |
243 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47806487 |
atgttgaggtgagaaaaggactaactgaagatgatgtctctgct |
47806530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 36 - 106
Target Start/End: Original strand, 47803499 - 47803570
Alignment:
Q |
36 |
attgattttgaaacatgtac-tttcagtaattttatcttaaaatcatgctcatgcagatatgcaattttatc |
106 |
Q |
|
|
|||||||||||||||||||| |||||||||||| |||| | || | || ||||| | ||||||||||||||| |
|
|
T |
47803499 |
attgattttgaaacatgtacttttcagtaatttcatctcataaccgtgttcatgtaaatatgcaattttatc |
47803570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University