View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_112 (Length: 251)
Name: NF0547_high_112
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_high_112 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 7196104 - 7195866
Alignment:
| Q |
1 |
aaagatgacaatgatcagaaggtggtgatgaactatgagtactatttgttgaactcaccttgtgatcttccatttgtggaatctttgaattagactcatc |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7196104 |
aaagatgacaatgatcagaaggtgatgatgaactatgagtactatttgttgaactcaccttgtgatcttccatttgtggaatctttgaattagactcatc |
7196005 |
T |
|
| Q |
101 |
atcaccaaccatcaattgatcttgatgatcaaagtcaatgaaaaaatcagcaatagaagtttcatcacttccttgatcatactcacttccactattcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7196004 |
atcaccaaccatcaattgatcttgatgatcaaagtcaatgaaaaaatcagcaatagaagtttcatcacttccttgatcatactcacttccactattcttt |
7195905 |
T |
|
| Q |
201 |
tccaaaattttgtattgatgaacagccttcagtctccta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7195904 |
tccaaaattttgtattgatgaacagccttcagtctccta |
7195866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1371 times since January 2019
Visitors: 3669