View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_113 (Length: 251)
Name: NF0547_high_113
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_high_113 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 25 - 222
Target Start/End: Complemental strand, 27957762 - 27957565
Alignment:
| Q |
25 |
tgtgtttttgtgaaaaatgggttcatgaatgcttgtacacattaacaatataagttcttgttaacgaaagtccaacaaaagattttgaaatggggaggag |
124 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
27957762 |
tgtgttttcgtgaaaaatgggttcatgaatgctggtacacattaacaatataagttctcgttaacaaaagtccaacaaaagattttgaaacggggaggag |
27957663 |
T |
|
| Q |
125 |
attgaggcaaggtgatccacaaccacgttatcttttttcattgtagctgaatgtttgaggtcatgatgactaaaacagtaaatttaagaggaagtttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27957662 |
attgaggcaaggtgatccacaaccacgttatctttttttattgtagcttaatgttcgaggtcatgatgactaaaacagtaaatttaggaggaagtttt |
27957565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 25 - 78
Target Start/End: Original strand, 16331188 - 16331241
Alignment:
| Q |
25 |
tgtgtttttgtgaaaaatgggttcatgaatgcttgtacacattaacaatataag |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16331188 |
tgtgtttttgtgaaaaatgggttcatgaatgcttgtacacattaacaatataag |
16331241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1023 times since January 2019
Visitors: 3662