View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_122 (Length: 228)
Name: NF0547_high_122
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_high_122 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 2e-23; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 24 - 99
Target Start/End: Original strand, 24634461 - 24634536
Alignment:
Q |
24 |
ttgatacataattccaattgaacccaactgcaaactcataagaatcatatatgttttatggatactcattttgtgt |
99 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||| ||||| |||||| |||||||||||||||||||||| |
|
|
T |
24634461 |
ttgatacataattccaattgaacccaactccaaactcatcagaatagtatatgctttatggatactcattttgtgt |
24634536 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 98
Target Start/End: Original strand, 24680132 - 24680206
Alignment:
Q |
24 |
ttgatacataattccaattgaacccaactgcaaactcataagaatcatatatgttttatggatactcattttgtg |
98 |
Q |
|
|
||||||||||||||||||||| | ||||| ||| ||||| ||||| |||||| ||||| || |||||||||||| |
|
|
T |
24680132 |
ttgatacataattccaattgagctcaactccaagctcatgagaatagtatatgctttatagaaactcattttgtg |
24680206 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 90 - 123
Target Start/End: Original strand, 24704126 - 24704159
Alignment:
Q |
90 |
cattttgtgttgtttgtgctgatcgggggaagat |
123 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
24704126 |
cattttgtgttgtttgtgctgatcgggggaagat |
24704159 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 36 - 99
Target Start/End: Original strand, 24656577 - 24656640
Alignment:
Q |
36 |
tccaattgaacccaactgcaaactcataagaatcatatatgttttatggatactcattttgtgt |
99 |
Q |
|
|
||||||||||||||||| || |||||||||| |||||| |||||| ||||||||||||||| |
|
|
T |
24656577 |
tccaattgaacccaactctaaggtcataagaatagtatatgctttatgcatactcattttgtgt |
24656640 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 166
Target Start/End: Original strand, 24704181 - 24704209
Alignment:
Q |
138 |
caagggagtttagggggattcaaatatac |
166 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
24704181 |
caagggagtttagggggattcaaatatac |
24704209 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University