View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_128 (Length: 201)
Name: NF0547_high_128
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_high_128 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 7 - 172
Target Start/End: Complemental strand, 28471146 - 28470981
Alignment:
| Q |
7 |
gttcttgcacattttcataaacttactcctgcgaaagcacggcagttacgagtgatactttgctctacttctctcaatgatcgttcgattgaggaacatt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28471146 |
gttcttgcacattttcataaacttactcctgcgaaagcacgactgttacgagtgatactttgctctacttctctcaatgatcgttcggttgaggaacatt |
28471047 |
T |
|
| Q |
107 |
tgctttgaatcaagaatcatgtagttgcgcttgcgcctgttggtgatccagttttctcgcaacagc |
172 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
28471046 |
tgctttgaatcaagaaccgtgtagttgcgcttgcacctgttggtgatccagttttgtcgcaacagc |
28470981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 450 times since January 2019
Visitors: 3651