View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_129 (Length: 201)
Name: NF0547_high_129
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_high_129 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 16 - 181
Target Start/End: Original strand, 28470981 - 28471146
Alignment:
Q |
16 |
gctgttgcgagaaaactggatcaccaacaggcgcaagcgcaactacatgattcttgattcaaagcaaatgttcctcaatcgaacgatcattgagagaagt |
115 |
Q |
|
|
|||||||||| |||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
28470981 |
gctgttgcgacaaaactggatcaccaacaggtgcaagcgcaactacacggttcttgattcaaagcaaatgttcctcaaccgaacgatcattgagagaagt |
28471080 |
T |
 |
Q |
116 |
agagcaaagtatcactcgtaactgccgtgctttcgcaggagtaagtttatgaaaatgtgcaagaac |
181 |
Q |
|
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28471081 |
agagcaaagtatcactcgtaacagtcgtgctttcgcaggagtaagtttatgaaaatgtgcaagaac |
28471146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1351 times since January 2019
Visitors: 3668