View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_69 (Length: 297)
Name: NF0547_high_69
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_high_69 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 40870440 - 40870242
Alignment:
| Q |
1 |
aacttggtagatgatttgagacatttgatttcatatacctgtggtagagtcaagccagattgataatgatccatggtctagtttctgatgctgagctccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40870440 |
aacttggtagatgatttgagacatttgatttcatatacctgtggtagagtcaagccagattgataatgatccatggtctagtttctgatgctgagctccc |
40870341 |
T |
 |
| Q |
101 |
catagatttctaaattcttgatcaaagctaatagtgcttactttggaactagggtagtaccctggtgatggtgcacacccagcattacgactacacatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40870340 |
catagatttctaaattcttgatcaaagctaatagtgcttactttggaactagggtagtaccctggtgatggtgcacccccagcattacgactacacatc |
40870242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 228 - 268
Target Start/End: Complemental strand, 40870213 - 40870173
Alignment:
| Q |
228 |
gagccatacagagtgatgatggcaagaaaattagaggcagg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40870213 |
gagccatacagagtgatgatggcaagaaaattagaggcagg |
40870173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 16 - 67
Target Start/End: Original strand, 43100111 - 43100162
Alignment:
| Q |
16 |
ttgagacatttgatttcatatacctgtggtagagtcaagccagattgataat |
67 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
43100111 |
ttgagacatttgatttcatatacctgatgtagagtcgagccagattgttaat |
43100162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University