View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0547_high_72 (Length: 285)

Name: NF0547_high_72
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0547_high_72
NF0547_high_72
[»] chr1 (2 HSPs)
chr1 (91-240)||(11560987-11561136)
chr1 (231-270)||(11560931-11560970)


Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 91 - 240
Target Start/End: Complemental strand, 11561136 - 11560987
Alignment:
91 tgttgttgcagtcacttggatcatgttggagcattggcttacttcactgaagtttgtgggtatagtggaccggtttatatgacggtgggttgcctattac 190  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
11561136 tgttggtgcagtcacttggatcatgttggagcattggcttacttcactgaagtttgtgggtatagtggaccggtttatatgacggtgggtcgcctattac 11561037  T
191 ctgtttgatgaaatgtctaactcaatgtaatgctatgaacactctctttt 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
11561036 ctgtttgatgaaatgtctaactcaatgtaatgctatgaacactctctttt 11560987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 231 - 270
Target Start/End: Complemental strand, 11560970 - 11560931
Alignment:
231 actctcttttattcgatgaaatcaatataagacccaccat 270  Q
    ||||||||||||||||||||||||||||||||||||||||    
11560970 actctcttttattcgatgaaatcaatataagacccaccat 11560931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 912 times since January 2019
Visitors: 3660