View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0547_high_76 (Length: 279)

Name: NF0547_high_76
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0547_high_76
NF0547_high_76
[»] chr7 (3 HSPs)
chr7 (12-93)||(39075571-39075652)
chr7 (188-269)||(39075745-39075826)
chr7 (188-246)||(46007524-46007581)
[»] chr1 (2 HSPs)
chr1 (188-249)||(30380265-30380326)
chr1 (12-88)||(30380431-30380507)


Alignment Details
Target: chr7 (Bit Score: 82; Significance: 9e-39; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 12 - 93
Target Start/End: Original strand, 39075571 - 39075652
Alignment:
12 catgtgattgctgggaagtttaaattggggaggaaaattggaagtgggtcttttggggagctttatataggtttgtttcatg 93  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39075571 catgtgattgctgggaagtttaaattggggaggaaaattggaagtgggtcttttggggagctttatataggtttgtttcatg 39075652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 188 - 269
Target Start/End: Original strand, 39075745 - 39075826
Alignment:
188 tatcagctgttaatgtacaaactggggaggaggttgctgttaagctggtatgttaagttctcatgaagttattagccctatg 269  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39075745 tatcagctgttaatgtacaaactggggaggaggttgctgttaagctggtatgttaagttctcatgaagttattagccctatg 39075826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 246
Target Start/End: Original strand, 46007524 - 46007581
Alignment:
188 tatcagctgttaatgtacaaactggggaggaggttgctgttaagctggtatgttaagtt 246  Q
    |||||||| ||||| |||||||||| ||| |||| |||||||||||||||||| |||||    
46007524 tatcagctattaatatacaaactggagag-aggtggctgttaagctggtatgtgaagtt 46007581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 188 - 249
Target Start/End: Complemental strand, 30380326 - 30380265
Alignment:
188 tatcagctgttaatgtacaaactggggaggaggttgctgttaagctggtatgttaagttctc 249  Q
    |||||||||||||| |||||||||| |||||||| |||||||||||||||||| ||||||||    
30380326 tatcagctgttaatatacaaactggagaggaggtggctgttaagctggtatgtgaagttctc 30380265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 12 - 88
Target Start/End: Complemental strand, 30380507 - 30380431
Alignment:
12 catgtgattgctgggaagtttaaattggggaggaaaattggaagtgggtcttttggggagctttatataggtttgtt 88  Q
    |||||||||| ||| ||||||||| | || ||||||||||| ||||| |||||||| ||||||||| ||||||||||    
30380507 catgtgattggtggaaagtttaaacttggaaggaaaattgggagtggttcttttggagagctttatttaggtttgtt 30380431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University