View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_76 (Length: 279)
Name: NF0547_high_76
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_high_76 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 9e-39; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 12 - 93
Target Start/End: Original strand, 39075571 - 39075652
Alignment:
Q |
12 |
catgtgattgctgggaagtttaaattggggaggaaaattggaagtgggtcttttggggagctttatataggtttgtttcatg |
93 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39075571 |
catgtgattgctgggaagtttaaattggggaggaaaattggaagtgggtcttttggggagctttatataggtttgtttcatg |
39075652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 188 - 269
Target Start/End: Original strand, 39075745 - 39075826
Alignment:
Q |
188 |
tatcagctgttaatgtacaaactggggaggaggttgctgttaagctggtatgttaagttctcatgaagttattagccctatg |
269 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39075745 |
tatcagctgttaatgtacaaactggggaggaggttgctgttaagctggtatgttaagttctcatgaagttattagccctatg |
39075826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 246
Target Start/End: Original strand, 46007524 - 46007581
Alignment:
Q |
188 |
tatcagctgttaatgtacaaactggggaggaggttgctgttaagctggtatgttaagtt |
246 |
Q |
|
|
|||||||| ||||| |||||||||| ||| |||| |||||||||||||||||| ||||| |
|
|
T |
46007524 |
tatcagctattaatatacaaactggagag-aggtggctgttaagctggtatgtgaagtt |
46007581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 188 - 249
Target Start/End: Complemental strand, 30380326 - 30380265
Alignment:
Q |
188 |
tatcagctgttaatgtacaaactggggaggaggttgctgttaagctggtatgttaagttctc |
249 |
Q |
|
|
|||||||||||||| |||||||||| |||||||| |||||||||||||||||| |||||||| |
|
|
T |
30380326 |
tatcagctgttaatatacaaactggagaggaggtggctgttaagctggtatgtgaagttctc |
30380265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 12 - 88
Target Start/End: Complemental strand, 30380507 - 30380431
Alignment:
Q |
12 |
catgtgattgctgggaagtttaaattggggaggaaaattggaagtgggtcttttggggagctttatataggtttgtt |
88 |
Q |
|
|
|||||||||| ||| ||||||||| | || ||||||||||| ||||| |||||||| ||||||||| |||||||||| |
|
|
T |
30380507 |
catgtgattggtggaaagtttaaacttggaaggaaaattgggagtggttcttttggagagctttatttaggtttgtt |
30380431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 504 times since January 2019
Visitors: 3651