View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_78 (Length: 277)
Name: NF0547_high_78
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_high_78 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 6 - 91
Target Start/End: Original strand, 39498700 - 39498787
Alignment:
Q |
6 |
agcagcacagaagggcctaataattgataaacaaaggtatgaatttggatactcacatcttcc--aacaatatgaaaatgtcacaaaa |
91 |
Q |
|
|
|||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||||| | || || ||||||||||||||||| |
|
|
T |
39498700 |
agcaacacaaaagggcctaataattgttaaacaaaggtatgaatttggatactcacatctttcaaaaaaaaatgaaaatgtcacaaaa |
39498787 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 231 - 262
Target Start/End: Original strand, 39498916 - 39498947
Alignment:
Q |
231 |
tcatacccaacaggataaacattgccataaat |
262 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
39498916 |
tcatacccaacaggataaacattgccataaat |
39498947 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University