View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_89 (Length: 262)
Name: NF0547_high_89
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_high_89 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 2 - 232
Target Start/End: Original strand, 7196122 - 7196352
Alignment:
| Q |
2 |
cctcaagagatccttttggatgtggagcttaagaagatggcttcctttcttggacttgaaaatgattgaagtgatttattccaatgatgggaccaagaga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7196122 |
cctcaagagatccttttggatgtggagcttaagaagatggcttcctttcttggacttgaaaatgattgaagtgatttattccaatgaggggaccaagaga |
7196221 |
T |
 |
| Q |
102 |
aaaaggtcaagtgaattgggaatcatatagcctttgctatatgccatttttatatgtatttcctaactaaacatgtaactagatgaacaagttcttggct |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7196222 |
aaaaggtcaagtgaattgggaatcatatagcctttgctatatgccatttttatatgtatttcctaactaaacatgtaactagatgaacaagttcttggct |
7196321 |
T |
 |
| Q |
202 |
tcttctttatgtcacttgatcaccaatcctt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7196322 |
tcttctttatgtcacttgatcaccaatcctt |
7196352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University