View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_91 (Length: 261)
Name: NF0547_high_91
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_high_91 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 31404091 - 31404336
Alignment:
| Q |
1 |
catggattatgaacacaccttactttgcaaggtggctcaaaaagttatcctgaaatgctttagagaaatatcagtcactcattgcatgtttgcaacttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31404091 |
catggattatgaacacaccttactttgcaaggtggctcaaaaagttatcctgaaatgctttagagaaatatcagtcactcattgcatgtttgcaacttct |
31404190 |
T |
 |
| Q |
101 |
gtactgtgagctttctttgcatcattgctattagcctatataactcaaagagaacccgttcaatgagactttctatgtggagacaaaatttcgtacatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31404191 |
gtactgtgagctttctttgcatcattgcta-tagcctatataactcaaagagaacccgttcaatgagactttctatgtggagacaaaattgtgtacatct |
31404289 |
T |
 |
| Q |
201 |
atttatatcatcatttatcactctcacttcattaatctaaaacatcc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31404290 |
atttatatcatcatttatcactctcacttcattaatctaaaacatcc |
31404336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 90 - 131
Target Start/End: Complemental strand, 31333429 - 31333388
Alignment:
| Q |
90 |
ttgcaacttctgtactgtgagctttctttgcatcattgctat |
131 |
Q |
| |
|
||||||||| ||||||||| ||||| |||||||||||||||| |
|
|
| T |
31333429 |
ttgcaacttttgtactgtgggctttttttgcatcattgctat |
31333388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University