View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_high_96 (Length: 256)
Name: NF0547_high_96
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_high_96 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 39280911 - 39281132
Alignment:
Q |
1 |
attaggttttttcccaattccttccatcaaggccaacaaagaatcagtttctcttaacagatcactattggtaagataagaaactcctttctctggcata |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
39280911 |
attaggttttttcccaattccttccatcaaggccaacaaagaatcagtttctcttaacagatcactattggtaagataagaaactcctttctctggcgtc |
39281010 |
T |
 |
Q |
101 |
gtttcaccgaggaagaaaccaagagttctagaagtacacagaaggttttcaatgtattccgcgtaccatcgaacccaagaagagagttcccaagatattg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39281011 |
gtttcaccgaggaagaaaccaagagttctagaagtacacagaaggttttcaatgtattccgcgtaccatcgaacccaagaagagagttcccaagatattg |
39281110 |
T |
 |
Q |
201 |
aacttgttttgtctctgaagtt |
222 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
39281111 |
aacttgttttgtctctgaagtt |
39281132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University