View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0547_high_97 (Length: 256)

Name: NF0547_high_97
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0547_high_97
NF0547_high_97
[»] chr3 (1 HSPs)
chr3 (1-232)||(39280704-39280935)


Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 39280935 - 39280704
Alignment:
1 ggaaggaattgggaaaaaacctaatactccaatgagtgaacagaacaaggtggttgttgagataatggatttggtggaagatgatggggttatggtgatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39280935 ggaaggaattgggaaaaaacctaatactccaatgagtgaacagaacaaggtggttgttgagataatggatttggtggaagatgatggggttatggtgatg 39280836  T
101 aatgaagttttggttagaattaaagaatttggggagagggagaaactgggctgtcttggttttggagaagtggtggaattggtttgtgttttgaagagat 200  Q
    |||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39280835 aatgaagttttggttagagttaatgaatttggggagagggagaaactgggctgtcttggttttggagaagtggtggaattggtttgtgttttgaagagat 39280736  T
201 tggaaatgtgcagagagagaataatgatgatg 232  Q
    ||||||||||||||||||||||||||||||||    
39280735 tggaaatgtgcagagagagaataatgatgatg 39280704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University