View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0547_low_103 (Length: 277)

Name: NF0547_low_103
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0547_low_103
NF0547_low_103
[»] chr8 (2 HSPs)
chr8 (6-91)||(39498700-39498787)
chr8 (231-262)||(39498916-39498947)


Alignment Details
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 6 - 91
Target Start/End: Original strand, 39498700 - 39498787
Alignment:
6 agcagcacagaagggcctaataattgataaacaaaggtatgaatttggatactcacatcttcc--aacaatatgaaaatgtcacaaaa 91  Q
    |||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |  || || |||||||||||||||||    
39498700 agcaacacaaaagggcctaataattgttaaacaaaggtatgaatttggatactcacatctttcaaaaaaaaatgaaaatgtcacaaaa 39498787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 231 - 262
Target Start/End: Original strand, 39498916 - 39498947
Alignment:
231 tcatacccaacaggataaacattgccataaat 262  Q
    ||||||||||||||||||||||||||||||||    
39498916 tcatacccaacaggataaacattgccataaat 39498947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 56 times since January 2019
Visitors: 3646