View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_105 (Length: 274)
Name: NF0547_low_105
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_low_105 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 37 - 274
Target Start/End: Complemental strand, 35422726 - 35422488
Alignment:
| Q |
37 |
gctatgagaataacgtatatcgttcaaaatttaataggatggggaagtttaacggtaataaggactgtgacaatttgttaatgacaaaacaattcacagc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
35422726 |
gctatgagaataacgtatatcgttcaaaatttaataggatggggaagtttaacggtaataaggactatgacaatttgttaatgacaaaacaattcacatc |
35422627 |
T |
|
| Q |
137 |
ataatctatctgtattccctttaatctcaacacatcattgtcaaacttatgatttatgtagttctt-aaaatcaataaatcacaaatgtaacatatcttc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35422626 |
ataatctatctgtattccctttaatctcaacacatcatcgtcaaacttatgatttatgtagttcttaaaaatcaataaatcacaaatgtaacatatcttc |
35422527 |
T |
|
| Q |
236 |
caagataggactaacttttagttgcttttgttggcttat |
274 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35422526 |
caagataggactaactttcggttgcttttgttggcttat |
35422488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 371 times since January 2019
Visitors: 3650