View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_106 (Length: 272)
Name: NF0547_low_106
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_106 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 38 - 178
Target Start/End: Original strand, 2938365 - 2938505
Alignment:
Q |
38 |
cgtgttgcagactacgagatgaagatggtcatatcatcgagaatactcaggtaacattttcttccatgttgggtttgctttataagtttgtagtttcgat |
137 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2938365 |
cgtgttgcagactacgagatgaagatggtcatatcatcgagaatactcaggtaacattttcttccatgttgggtttgctttataagtttgtagtttcgat |
2938464 |
T |
 |
Q |
138 |
gnnnnnnncagcatatagtttggtatcatttacaattttgt |
178 |
Q |
|
|
| ||||||||||||||||||||||||||||||||| |
|
|
T |
2938465 |
gaaaaaaacagcatatagtttggtatcatttacaattttgt |
2938505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 202 - 241
Target Start/End: Original strand, 2939017 - 2939056
Alignment:
Q |
202 |
tttcaccttccgcttctgactattgtttaaaatatctctg |
241 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
2939017 |
tttcaccttccgcttctgactattgtttaaaatctctctg |
2939056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 498 times since January 2019
Visitors: 3651