View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_107 (Length: 271)
Name: NF0547_low_107
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_low_107 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 50 - 239
Target Start/End: Complemental strand, 16252910 - 16252721
Alignment:
| Q |
50 |
ctatgtgcttttattttgtttttaaaaggatgttgtgatatgtttacgtaggtatagtgttacttaatagaaactagtttatgccctataagcataactg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16252910 |
ctatgtgcttttattttgtttttaaaaggatgtcgtgatatgtttatgtaggtatagtgttacttaatagaaactagtttatgccctatgagcataactg |
16252811 |
T |
|
| Q |
150 |
agttataacgacaatgcattgaaatatatatggagagttcggggttcgatctcagactccccacttattcatctttaaatacaatgttca |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16252810 |
agttataacgacaatgcattgaaatatatatggagagtttggggttcgatctcagacttcccacttattcatctttaaatacaatgttca |
16252721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 72 - 185
Target Start/End: Complemental strand, 16280852 - 16280737
Alignment:
| Q |
72 |
taaaaggatgttgtgatatgtttacgtaggtatagtgttacttaatagaaactagtttatgccctataagcataactgagttataacgacaatgc--att |
169 |
Q |
| |
|
|||||||||| || |||||| || ||||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||| ||| |
|
|
| T |
16280852 |
taaaaggatgcggtaatatgtgtatgtaggcatagtgttacttaatagaaattagtttatgccctatgagcataactgagttataacgacgatgcatatt |
16280753 |
T |
|
| Q |
170 |
gaaatatatatggaga |
185 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
16280752 |
gaaatatatatggaga |
16280737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1206 times since January 2019
Visitors: 3665