View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_109 (Length: 270)
Name: NF0547_low_109
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_low_109 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 36 - 270
Target Start/End: Original strand, 17449300 - 17449535
Alignment:
| Q |
36 |
ttgccacgatgaacatgcatgttgcaatggaaatgaagaaaataatacgaatggagaaaagcattgttgaagagaggaagatgagtggttggaaagcaag |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17449300 |
ttgccacgatgaacatgcatgttgcaatggaaatgaagaaaataatacgaatggagaaaagcattgttgaagagaggaagatgagtggttggaaagcaag |
17449399 |
T |
 |
| Q |
136 |
aggtttgaaagaagggaatgaaattatattgagtgagaggtttggttgatgagagttggagaagaagggaaattctaacttttcttttctttgttatcga |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17449400 |
aggtttgaaagaagggaatgaaattatattgagtgagaggttcggttgatgagagttggagaagaagggaaattctaacttttcttttctttgttatcga |
17449499 |
T |
 |
| Q |
236 |
ta-ttcttccattgatttgtgagtgaaattcacact |
270 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17449500 |
tatttcttccattgatttgtgagtgaaattcacact |
17449535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 209 - 270
Target Start/End: Original strand, 17449910 - 17449975
Alignment:
| Q |
209 |
tctaacttttcttttcttt---gttatcgatatt-cttccattgatttgtgagtgaaattcacact |
270 |
Q |
| |
|
||||| ||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17449910 |
tctaagttttcttttcttttctgttatagatatttcttccattgatttgtgagtgaaattcacact |
17449975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University