View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_115 (Length: 262)
Name: NF0547_low_115
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_low_115 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 40 - 262
Target Start/End: Original strand, 30653384 - 30653606
Alignment:
| Q |
40 |
tatcaaactggttgatgatatccttcacctagacatgagctaaaggcgcaaatatgggattataatctgcaaggaacattccatttgcaagccaaggcgt |
139 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30653384 |
tatcaaattggttgatgatatccttcaccttgacatgagctaaaggcacaaatatgggattataatatgcaaggaacattccatttgcaagccaaggcgc |
30653483 |
T |
 |
| Q |
140 |
accaaacaacagaatattggtacatgtacctatcttgcaccnnnnnnnnnnnnnnnnnnnngcggtgaaaatgcttttccacacataggtctagttaatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30653484 |
accaaacaacagaatattggtacatgtacatatcttgcacc-ttttttcacaactttttttgcggtgaaaatgcttttccaaacataggtctagttaatt |
30653582 |
T |
 |
| Q |
240 |
cccaatctt-gaacctataaaatc |
262 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
30653583 |
cccaatcttagaacctataaaatc |
30653606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University