View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_119 (Length: 260)
Name: NF0547_low_119
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_119 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 39075486 - 39075369
Alignment:
Q |
1 |
ctctagttgtgtataaaggggttcaaaattcaagctttattcgataatccacaacccccaatgagatttcccaccctatacgtccaatgatcgtgaaaca |
100 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39075486 |
ctctagttatgtataaaggggttcaaaattcaagctttattcgataatccacaacccccaatgagatttcccaccctatacgtccaatgatcgtgaaaca |
39075387 |
T |
 |
Q |
101 |
ctaataagggggaattcg |
118 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
39075386 |
ctaataagggggaattcg |
39075369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 147 - 228
Target Start/End: Complemental strand, 39075340 - 39075259
Alignment:
Q |
147 |
tttacacaaattgtaacgccccaaacaataaagatgaaaattttattataattgagaataattatacaagaaaatctacccc |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39075340 |
tttacacaaattgtaacgccccaaacaataaagatgaaaattttattataattgagaataattatacaagaaaatctacccc |
39075259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University