View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0547_low_122 (Length: 257)

Name: NF0547_low_122
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0547_low_122
NF0547_low_122
[»] chr4 (1 HSPs)
chr4 (12-229)||(38090086-38090303)


Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 12 - 229
Target Start/End: Complemental strand, 38090303 - 38090086
Alignment:
12 atgaaggtgtgtttgggaaataggtaacttctgagattggattagaagattctgaatagagagaaagacactgaagaagggtattattggtattaatatt 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38090303 atgaaggtgtgtttgggaaataggtaacttctgagattggattagaagattctgaatagagagaaagacactgaagaagggtattattggtattaatatt 38090204  T
112 attatgttggagcagagaatctgaagaagacactggtactagaatgtggaatactaagaagaatggaacaagggatgctacaattgtatgcatcttaaca 211  Q
    ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38090203 attatgttggatcaaagaatctgaagaagacactggtactagaatgtggaatactaagaagaatggaacaagggatgctacaattgtatgcatcttaaca 38090104  T
212 ggaaaaagattgagaatt 229  Q
    ||||||||||||||||||    
38090103 ggaaaaagattgagaatt 38090086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 734 times since January 2019
Visitors: 3656