View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_124 (Length: 256)
Name: NF0547_low_124
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_124 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 39280935 - 39280704
Alignment:
Q |
1 |
ggaaggaattgggaaaaaacctaatactccaatgagtgaacagaacaaggtggttgttgagataatggatttggtggaagatgatggggttatggtgatg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39280935 |
ggaaggaattgggaaaaaacctaatactccaatgagtgaacagaacaaggtggttgttgagataatggatttggtggaagatgatggggttatggtgatg |
39280836 |
T |
 |
Q |
101 |
aatgaagttttggttagaattaaagaatttggggagagggagaaactgggctgtcttggttttggagaagtggtggaattggtttgtgttttgaagagat |
200 |
Q |
|
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39280835 |
aatgaagttttggttagagttaatgaatttggggagagggagaaactgggctgtcttggttttggagaagtggtggaattggtttgtgttttgaagagat |
39280736 |
T |
 |
Q |
201 |
tggaaatgtgcagagagagaataatgatgatg |
232 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
39280735 |
tggaaatgtgcagagagagaataatgatgatg |
39280704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1343 times since January 2019
Visitors: 3667