View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_131 (Length: 251)
Name: NF0547_low_131
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_low_131 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 52141401 - 52141164
Alignment:
| Q |
1 |
taattgtaagcaagaactgaaaagaaaccttggccatgagcttttcgtgttcttctgctcgtttcacgattttaacggcttgtttggaaatcatttgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52141401 |
taattgtaagcaagaactgaaaagaaaccttggcgatgagcttttcgtgttcttctgctcgtttcacgattttaacggcttgtttggaaatcatttgctt |
52141302 |
T |
|
| Q |
101 |
ggtttgcacaacttgtttggaaatcaattccttcattgctgaactaggcttctgcattatcatattcatgcatgagttacttgaaatcattcaaatgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52141301 |
ggtttgcacaacttgtttggaaatcaattccttcattgctgaactaggcttctgcattatcatattcatgcatgagttacttgatatcattcaaatgaaa |
52141202 |
T |
|
| Q |
201 |
atgaatgttaaatacagtttttagttacctacttacct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52141201 |
atgaatgttaaatacagtttttagttacctacttacct |
52141164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 490 times since January 2019
Visitors: 3651