View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_142 (Length: 251)
Name: NF0547_low_142
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_142 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 48779918 - 48780161
Alignment:
Q |
1 |
tggttttgaatatcttgaacttgatgagcagattgggccactaatgtaaacgttttgagatcatcatgtgtctgctgctgtcactct--atatattacca |
98 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
48779918 |
tggttttgaatatcttgaacttgatgggcagattgggccactaatgtaaacgttttgagatcatcatgtgtctgctgctgtcactctttatatattacca |
48780017 |
T |
 |
Q |
99 |
accgttgtattttccgctcactatgtcatactgtctgcaataaacatatatgcaatttcttctctaatttccttgcaattttctttctcaaatatgaata |
198 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48780018 |
accgttgtattttccgctcactatgtcatactgtctgcaataaacatatatgcaatttcttctctaatttccttgcaattttctttctcaaatatgaata |
48780117 |
T |
 |
Q |
199 |
ttgctaaagannnnnnncttcactgattgaagatgggttcatct |
242 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
T |
48780118 |
ttgctaaagatttttttcttcactgattgaagatgggttcatct |
48780161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University