View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_146 (Length: 244)
Name: NF0547_low_146
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_low_146 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 16 - 244
Target Start/End: Complemental strand, 3790928 - 3790700
Alignment:
| Q |
16 |
atcgaattagtccatctctttgtcaaatgtttttcaattaggttttgttttatgtttttgtaacatgactagggacttaactcagaaacttttgacaaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
3790928 |
atcgaattagtccatctctttgtcaaatgtttttcaattatgttttgttatatgtttttgtaacatgactagggacttaactgagaaacttttgtcaaat |
3790829 |
T |
 |
| Q |
116 |
agaaactagtttatgtaagtatattannnnnnncaatgatgaaatattgttttttcaatgaggaaagtatatggcaaatgatgattaattttaacgctta |
215 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3790828 |
agaaactagtttatataagtatattatttttttcaatgatgaaatattgttttttcaatgaggaaagtatatggcaaatgatgattaattttaacgctta |
3790729 |
T |
 |
| Q |
216 |
ttgatatactgaataaaaagtgttgacaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3790728 |
ttgatatactgaataaaaagtgttgacaa |
3790700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 173 - 244
Target Start/End: Original strand, 6845539 - 6845610
Alignment:
| Q |
173 |
atgaggaaagtatatggcaaatgatgattaattttaacgcttattgatatactgaataaaaagtgttgacaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6845539 |
atgaggaaagtatatggcaaatgatgattaattttaacgcttattgatatactgaataacaagtgttgacaa |
6845610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 32 - 91
Target Start/End: Original strand, 27293342 - 27293403
Alignment:
| Q |
32 |
tctttgtcaaatgtttttcaattaggt-tttgt-tttatgtttttgtaacatgactagggac |
91 |
Q |
| |
|
|||||| |||| |||| |||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
27293342 |
tctttgccaaaagtttctcaattaggtctttgtctttatgtttttgtaacatgactagggac |
27293403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 114
Target Start/End: Complemental strand, 33229603 - 33229553
Alignment:
| Q |
64 |
tttatgtttttgtaacatgactagggacttaactcagaaacttttgacaaa |
114 |
Q |
| |
|
||||||||||||| ||||||| |||||| ||| | |||||||||||||||| |
|
|
| T |
33229603 |
tttatgtttttgtcacatgacgagggacctaattgagaaacttttgacaaa |
33229553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 114
Target Start/End: Original strand, 10525008 - 10525058
Alignment:
| Q |
64 |
tttatgtttttgtaacatgactagggacttaactcagaaacttttgacaaa |
114 |
Q |
| |
|
||||||||||||| ||||||| |||||| ||| | |||||||||||||||| |
|
|
| T |
10525008 |
tttatgtttttgtcacatgacgagggacctaattgagaaacttttgacaaa |
10525058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University