View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_152 (Length: 227)
Name: NF0547_low_152
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_152 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 137 - 214
Target Start/End: Complemental strand, 37835045 - 37834968
Alignment:
Q |
137 |
ctttgtcatacgtgctatatcatgtagtctggtggaggatgttattcgttgtacttttctctttaagcgtagggccct |
214 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37835045 |
ctttgtcatacgtgctatatcatgtagtctggtggaggatgttattcgttgtacttttctctttaagcgtagggccct |
37834968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 137 - 188
Target Start/End: Complemental strand, 12281042 - 12280991
Alignment:
Q |
137 |
ctttgtcatacgtgctatatcatgtagtctggtggaggatgttattcgttgt |
188 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
12281042 |
ctttgtcatacatgctatatcatgtagtctggtggaggatgttatccgttgt |
12280991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 42824078 - 42824127
Alignment:
Q |
38 |
ataaatagttgaattttaaatgaagtcagagaaaatgaaagaagtggtat |
87 |
Q |
|
|
||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
42824078 |
ataaatacttgaattttaaatgaagtcggagaaaatgaaagaagtggtat |
42824127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University