View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_154 (Length: 214)
Name: NF0547_low_154
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_low_154 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 51 - 197
Target Start/End: Complemental strand, 46630978 - 46630832
Alignment:
| Q |
51 |
tagctgttgctgatgatcttctaaaactccatctcttcttctcctttgagggtgttgttgaaacaggagtagttggattttctgttccatttgaaaaatt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46630978 |
tagctgttgctgatgatcttctaaaactccatctcttcttctcctttgagggtgttgttgaaacaggagtagttggattttctgttccatttgaaaaatt |
46630879 |
T |
|
| Q |
151 |
ctggtttgtgttacatttttccttctctttttctttgtccttcttcc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46630878 |
ctggtttgtgttacatttttccttctctttttctttgtccttcttcc |
46630832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 59 - 142
Target Start/End: Complemental strand, 15505201 - 15505121
Alignment:
| Q |
59 |
gctgatgatcttctaaaactccatctcttcttctcctttgagggtgttgttgaaacaggagtagttggattttctgttccattt |
142 |
Q |
| |
|
|||||||||||||| ||||||||||| | ||||||||| ||||||||||| | |||||||| |||||||| ||||||||| |
|
|
| T |
15505201 |
gctgatgatcttctgaaactccatcttcttttctccttt---ggtgttgttgagattggagtagtaggattttcagttccattt |
15505121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 10468412 - 10468456
Alignment:
| Q |
1 |
tgtacacaaatttaacaagtgaaaaaatcatacacacaatcacaa |
45 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10468412 |
tgtacacaaatttaacaagtgaacaaatcatacacacaatcacaa |
10468456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 772 times since January 2019
Visitors: 3656