View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_155 (Length: 213)
Name: NF0547_low_155
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0547_low_155 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 8 - 213
Target Start/End: Complemental strand, 18842121 - 18841916
Alignment:
| Q |
8 |
tttataatcaaggtcagaagaatgatgagaacaatatgcaagatcaattcctttgtttctggcattaaaatgtactttttgacaattgtaaatgtgtttt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18842121 |
tttataatcaaggtcagaagaatgatgagaacaatatgcaagatcaattcctttgtttctggcattaaaatgtactttttgacaattttaaatgtgtttt |
18842022 |
T |
 |
| Q |
108 |
caacagaaagcttgaagaaacttcttcccttgtttactttatagtccaatcctaaacaacctacaagctaaaactatcatcttacaagtttttatgtcat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18842021 |
caacagaaagcttgaagaaacttcttcccttgtttactttatagtcctatcctaaacaacctacaagctaaaactatcatcttacaagtttttatgtcat |
18841922 |
T |
 |
| Q |
208 |
agtaaa |
213 |
Q |
| |
|
|||||| |
|
|
| T |
18841921 |
agtaaa |
18841916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University