View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_156 (Length: 207)
Name: NF0547_low_156
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_156 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 23 - 171
Target Start/End: Original strand, 8457487 - 8457635
Alignment:
Q |
23 |
gaccatactcaagattttgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtaggctttcaggattttcgttttgattatgcaaaag |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8457487 |
gaccatactcaagattttgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtaggctttcaggattttcgttttgattatgcaaaag |
8457586 |
T |
 |
Q |
123 |
ggtaagatgtgctacactacacctttagaatattgagggttttcctttg |
171 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8457587 |
ggtaagatgtgctacactacacctttagaatattgagggttttcctttg |
8457635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 23 - 139
Target Start/End: Complemental strand, 6827843 - 6827728
Alignment:
Q |
23 |
gaccatactcaagattttgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtaggctttcaggattttcgttttgattatgcaaaag |
122 |
Q |
|
|
||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
T |
6827843 |
gaccacactcaagattgtgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtgggctttcaggattttcgttttgattatgc-aaag |
6827745 |
T |
 |
Q |
123 |
ggtaagatgtgctacac |
139 |
Q |
|
|
||||||||||||||||| |
|
|
T |
6827744 |
ggtaagatgtgctacac |
6827728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 23 - 139
Target Start/End: Original strand, 9822301 - 9822416
Alignment:
Q |
23 |
gaccatactcaagattttgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtaggctttcaggattttcgttttgattatgcaaaag |
122 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
T |
9822301 |
gaccacactcaagattttgtgagaaaggatatcataggatggcttcagtggctttgccataatgtgggctttcaggattttcgttttgattatgc-aaag |
9822399 |
T |
 |
Q |
123 |
ggtaagatgtgctacac |
139 |
Q |
|
|
||||||||||||||||| |
|
|
T |
9822400 |
ggtaagatgtgctacac |
9822416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 23 - 139
Target Start/End: Complemental strand, 27964486 - 27964371
Alignment:
Q |
23 |
gaccatactcaagattttgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtaggctttcaggattttcgttttgattatgcaaaag |
122 |
Q |
|
|
||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
T |
27964486 |
gaccacactcaagattgtgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtgggctttcaggattttcgttttgattatgc-aaag |
27964388 |
T |
 |
Q |
123 |
ggtaagatgtgctacac |
139 |
Q |
|
|
||||||||||||||||| |
|
|
T |
27964387 |
ggtaagatgtgctacac |
27964371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 207
Target Start/End: Complemental strand, 36408458 - 36408421
Alignment:
Q |
170 |
tgcttctttcaccgccaagcttcgactcgatctgatct |
207 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||| |
|
|
T |
36408458 |
tgcttctttcaccgccaagcttcgactcggtctgatct |
36408421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University