View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0547_low_156 (Length: 207)

Name: NF0547_low_156
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0547_low_156
NF0547_low_156
[»] chr1 (1 HSPs)
chr1 (23-171)||(8457487-8457635)
[»] chr8 (1 HSPs)
chr8 (23-139)||(6827728-6827843)
[»] chr6 (1 HSPs)
chr6 (23-139)||(9822301-9822416)
[»] chr3 (1 HSPs)
chr3 (23-139)||(27964371-27964486)
[»] chr2 (1 HSPs)
chr2 (170-207)||(36408421-36408458)


Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 23 - 171
Target Start/End: Original strand, 8457487 - 8457635
Alignment:
23 gaccatactcaagattttgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtaggctttcaggattttcgttttgattatgcaaaag 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8457487 gaccatactcaagattttgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtaggctttcaggattttcgttttgattatgcaaaag 8457586  T
123 ggtaagatgtgctacactacacctttagaatattgagggttttcctttg 171  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
8457587 ggtaagatgtgctacactacacctttagaatattgagggttttcctttg 8457635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 23 - 139
Target Start/End: Complemental strand, 6827843 - 6827728
Alignment:
23 gaccatactcaagattttgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtaggctttcaggattttcgttttgattatgcaaaag 122  Q
    ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||    
6827843 gaccacactcaagattgtgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtgggctttcaggattttcgttttgattatgc-aaag 6827745  T
123 ggtaagatgtgctacac 139  Q
    |||||||||||||||||    
6827744 ggtaagatgtgctacac 6827728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 23 - 139
Target Start/End: Original strand, 9822301 - 9822416
Alignment:
23 gaccatactcaagattttgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtaggctttcaggattttcgttttgattatgcaaaag 122  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| ||||    
9822301 gaccacactcaagattttgtgagaaaggatatcataggatggcttcagtggctttgccataatgtgggctttcaggattttcgttttgattatgc-aaag 9822399  T
123 ggtaagatgtgctacac 139  Q
    |||||||||||||||||    
9822400 ggtaagatgtgctacac 9822416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 23 - 139
Target Start/End: Complemental strand, 27964486 - 27964371
Alignment:
23 gaccatactcaagattttgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtaggctttcaggattttcgttttgattatgcaaaag 122  Q
    ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||    
27964486 gaccacactcaagattgtgtgagaaaggatatcataggatggcttcagtggcttcgccataatgtgggctttcaggattttcgttttgattatgc-aaag 27964388  T
123 ggtaagatgtgctacac 139  Q
    |||||||||||||||||    
27964387 ggtaagatgtgctacac 27964371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 170 - 207
Target Start/End: Complemental strand, 36408458 - 36408421
Alignment:
170 tgcttctttcaccgccaagcttcgactcgatctgatct 207  Q
    ||||||||||||||||||||||||||||| ||||||||    
36408458 tgcttctttcaccgccaagcttcgactcggtctgatct 36408421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University