View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0547_low_157 (Length: 206)

Name: NF0547_low_157
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0547_low_157
NF0547_low_157
[»] chr7 (1 HSPs)
chr7 (80-154)||(40758188-40758262)


Alignment Details
Target: chr7 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 80 - 154
Target Start/End: Complemental strand, 40758262 - 40758188
Alignment:
80 ggcagtggtttgatcatttatctcatgtctgatgtctctctgattcatattgtattcatgatggtggctgatcat 154  Q
    |||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||    
40758262 ggcagtggtttgatcattcatctcatgtctgatgtctctatgattcatattatattcatgatggtggctgatcat 40758188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University