View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_158 (Length: 203)
Name: NF0547_low_158
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_158 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 152
Target Start/End: Original strand, 31704361 - 31704512
Alignment:
Q |
1 |
cattaagattaaaattcaccaatttgatagcagactacatgaatctttaaccccttaatataccataatcatgaaagagatttaatatgtgacacattga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31704361 |
cattaagattaaaattcaccaatttgatagcagactacatgaatctttaaccccttaatataccataatcatgaaagagatttaatatgtgacacattga |
31704460 |
T |
 |
Q |
101 |
aaagttacagcactgtaaattcatttggaagatcatgtgtgcctatgatact |
152 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||| |||| |||| |
|
|
T |
31704461 |
aaagttacagtactgtaaattcatttggaagatcatgtgtgcttatgttact |
31704512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University