View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0547_low_159 (Length: 202)
Name: NF0547_low_159
Description: NF0547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0547_low_159 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 80 - 154
Target Start/End: Complemental strand, 40758262 - 40758188
Alignment:
Q |
80 |
ggcagtggtttgatcatttatctcatgtctgatgtctctctgattcatattgtattcatgatggtggctgatcat |
154 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
T |
40758262 |
ggcagtggtttgatcattcatctcatgtctgatgtctctatgattcatattatattcatgatggtggctgatcat |
40758188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 695 times since January 2019
Visitors: 3655